circad | circRNAs associated with diseases

hsa_circ_0071589
Gene	FAT1	Organism	Human
Genome Locus	chr4:187517693-187518946:-	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	29710537
Experimental Method
Sample Type	Tissues	Comparison	comparison of Colorectal Cancer tissues with normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAAACTCCCCTTCTGACAGC Reverse CCGAATCACACTGACAAACG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yong, W, Zhuoqi, X, Baocheng, W, Dongsheng, Z, Chuan, Z, Yueming, S (2018). Hsa_circ_0071589 promotes carcinogenesis via the miR-600/EZH2 axis in colorectal cancer. Biomed. Pharmacother., 102:1188-1194.